Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 133829
End position: 133852
Length: 24

DNA sequence
>NC_019949, from 133829 to 133852 (24 bp); Mycoplasma cynos C142 TGAGAATGATAATAAGAATGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 133671-134621	Sequence	MCYN_0126 MCYN0126 Putative sugar ABC transporter permease protein (Protein is coded in complementary strand; from 134621 to 133671)