Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 161559
End position: 161582
Length: 24

DNA sequence
>NC_019949, from 161559 to 161582 (24 bp); Mycoplasma cynos C142 TTTTTATTATTATTTTGATTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 159582-161717	Sequence	MCYN_0152 MCYN0152 hypothetical protein (Protein is coded in complementary strand; from 161717 to 159582)