Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 165543
End position: 165572
Length: 30

DNA sequence
>NC_019949, from 165543 to 165572 (30 bp); Mycoplasma cynos C142 AATATTTTTTTATACTTTTTCATAATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 165072-165566	Sequence	MCYN_0155 MCYN0155 Variant surface antigen C (Protein is coded in complementary strand; from 165566 to 165072)
ORF. 165424-165597	Sequence	MCYN_0156 MCYN0156 Hypothetical protein