Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 172313
End position: 172342
Length: 30

DNA sequence
>NC_019949, from 172313 to 172342 (30 bp); Mycoplasma cynos C142 TTATTATTTGTTATTTTATGTTTTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 172059-172496	Sequence	MCYN_0164 MCYN0164 Large conductance mechanosensitive channel protein