Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 20606
End position: 20629
Length: 24

DNA sequence
>NC_019949, from 20606 to 20629 (24 bp); Mycoplasma cynos C142 ATTTTTTTATCTTTTTATTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 17737-20640	Sequence	MCYN_0022 MCYN0022 hypothetical protein (Protein is coded in complementary strand; from 20640 to 17737)
ORF... 20613-21086	Sequence	MCYN_0023 MCYN0023 Hypothetical protein (Protein is coded in complementary strand; from 21086 to 20613)