Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 402436
End position: 402462
Length: 27

DNA sequence
>NC_019949, from 402436 to 402462 (27 bp); Mycoplasma cynos C142 AAATTTGAGAAATTTCAGAAATTGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 401451-402539	Sequence	MCYN_0382 MCYN0382 hypothetical protein (Protein is coded in complementary strand; from 402539 to 401451)