Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 488558
End position: 488584
Length: 27

DNA sequence
>NC_019949, from 488558 to 488584 (27 bp); Mycoplasma cynos C142 AAATTTGAGAAATTTCAGAAATTGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 487852-488661	Sequence	MCYN_0464 MCYN0464 Predicted transposase for IS1630-like insertion sequence element (Protein is coded in complementary strand; from 488661 to 487852)