Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 519653
End position: 519677
Length: 25

DNA sequence
>NC_019949, from 519653 to 519677 (25 bp); Mycoplasma cynos C142 ACAATAAAATATAATTCAATTCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 519214-520242	Sequence	MCYN_0490 MCYN0490 Glycosyltransferase (Protein is coded in complementary strand; from 520242 to 519214)