Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 63556
End position: 63585
Length: 30

DNA sequence
>NC_019949, from 63556 to 63585 (30 bp); Mycoplasma cynos C142 CATTTTTGCATATTTTTTCACATTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 63133-63579	Sequence	MCYN_0064 MCYN0064 Hypothetical protein (Protein is coded in complementary strand; from 63579 to 63133)