Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 740398
End position: 740422
Length: 25

DNA sequence
>NC_019949, from 740398 to 740422 (25 bp); Mycoplasma cynos C142 TATTTTCTTTTGTTTTCTTTTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 738512-740425	Sequence	MCYN_0653 MCYN0653 Hypothetical protein (Protein is coded in complementary strand; from 740425 to 738512)