Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 779106
End position: 779132
Length: 27

DNA sequence
>NC_019949, from 779106 to 779132 (27 bp); Mycoplasma cynos C142 ATATTTTCAATAATTTCAATAATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 777870-779501	Sequence	MCYN_0683 MCYN0683 CTP synthase (Protein is coded in complementary strand; from 779501 to 777870)