Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 795741
End position: 795764
Length: 24

DNA sequence
>NC_019949, from 795741 to 795764 (24 bp); Mycoplasma cynos C142 TTTTTCATTTTCTTTTTCTTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 794503-795852	Sequence	MCYN_0698 MCYN0698 Hypothetical protein (Protein is coded in complementary strand; from 795852 to 794503)