Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 807964
End position: 807987
Length: 24

DNA sequence
>NC_019949, from 807964 to 807987 (24 bp); Mycoplasma cynos C142 GGTTTTGGATTTGGTTGTGGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 807748-813138	Sequence	MCYN_0715 MCYN0715 F5/8 type C domain protein (Protein is coded in complementary strand; from 813138 to 807748)