Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 832568
End position: 832603
Length: 36

DNA sequence
>NC_019949, from 832568 to 832603 (36 bp); Mycoplasma cynos C142 TAATTTCATTTTTAATATAATTTTTAAACTCATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 832024-833163	Sequence	MCYN_0739 MCYN0739 S-adenosylmethionine synthase (Protein is coded in complementary strand; from 833163 to 832024)