Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 841791
End position: 841820
Length: 30

DNA sequence
>NC_019949, from 841791 to 841820 (30 bp); Mycoplasma cynos C142 AATATTTTTTTATACTTTTTCATAATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 840366-841814	Sequence	MCYN_0747 MCYN0747 Hypothetical protein (Protein is coded in complementary strand; from 841814 to 840366)