Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 966864
End position: 966899
Length: 36

DNA sequence
>NC_019949, from 966864 to 966899 (36 bp); Mycoplasma cynos C142 TTTTTAGAATCATTTATAAAATCATTTTTATAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 966414-967013	Sequence	MCYN_0858 MCYN0858 Ribonuclease HII (Protein is coded in complementary strand; from 967013 to 966414)