Sequence retrieval

Genome: Mycoplasma cynos C142
Start position: 983942
End position: 983965
Length: 24

DNA sequence
>NC_019949, from 983942 to 983965 (24 bp); Mycoplasma cynos C142 CAAATGCCAATGGAAATGCAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 983758-991893	Sequence	MCYN_0877 MCYN0877 Putative ABC transporter permease protein (Protein is coded in complementary strand; from 991893 to 983758)