Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 443785
End position: 443826
Length: 42

DNA sequence
>NC_019955, from 443785 to 443826 (42 bp); Vibrio parahaemolyticus BB22OP TGTGTCTGTGTCTGTGTCTGTGTCTGTGTCTGTGTCTGTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 443740-444342	Sequence	VPBB_0427 - 21 kDa hemolysin precursor (Protein is coded in complementary strand; from 444342 to 443740)