Sequence retrieval

Genome: Riemerella anatipestifer RA-CH-2
Start position: 46214
End position: 46237
Length: 24

DNA sequence
>NC_020125, from 46214 to 46237 (24 bp); Riemerella anatipestifer RA-CH-2 AAAAACAAAAAGTAAAACAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 46155-46679	Sequence	G148_0035 - hypothetical protein (Protein is coded in complementary strand; from 46679 to 46155)