Sequence retrieval

Genome: Riemerella anatipestifer RA-CH-2
Start position: 474769
End position: 474792
Length: 24

DNA sequence
>NC_020125, from 474769 to 474792 (24 bp); Riemerella anatipestifer RA-CH-2 AAATTAAAATTAAAATCAAAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 474768-475007	Sequence	G148_0467 - hypothetical protein (Protein is coded in complementary strand; from 475007 to 474768)