Sequence retrieval

Genome: Riemerella anatipestifer RA-CH-2
Start position: 946835
End position: 946858
Length: 24

DNA sequence
>NC_020125, from 946835 to 946858 (24 bp); Riemerella anatipestifer RA-CH-2 AGCGGCAACGGCAGCAGCAGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 946434-947117	Sequence	G148_0892 - putative Zn-dependent protease (Protein is coded in complementary strand; from 947117 to 946434)