Sequence retrieval

Genome: Riemerella anatipestifer RA-CH-2
Start position: 1172394
End position: 1172418
Length: 25

DNA sequence
>NC_020125, from 1172394 to 1172418 (25 bp); Riemerella anatipestifer RA-CH-2 AAAATAAAATTAAATATAATCAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1171895-1172401	Sequence	G148_1103 - hypothetical protein
ORF... 1172418-1173029	Sequence	G148_1104 - Inorganic pyrophosphatase