Sequence retrieval

Genome: Riemerella anatipestifer RA-CH-2
Start position: 390070
End position: 390117
Length: 48

DNA sequence
>NC_020125, from 390070 to 390117 (48 bp); Riemerella anatipestifer RA-CH-2 TAACCGTAACCGTAGCCATAACCGTAGCCATAACCGTAACCGTAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 389986-392484	Sequence	G148_0383 - ATPases involved in chromosome partitioning (Protein is coded in complementary strand; from 392484 to 389986)