Sequence retrieval

Genome: Bartonella australis Aust NH1
Start position: 1081647
End position: 1081670
Length: 24

DNA sequence
>NC_020300, from 1081647 to 1081670 (24 bp); Bartonella australis Aust NH1 CCTCATCCTCTTCCTCATCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1080368-1082365	Sequence	BAnh1_08590 rpoD RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 1082365 to 1080368)