Sequence retrieval

Genome: Bartonella australis Aust NH1
Start position: 1204607
End position: 1204630
Length: 24

DNA sequence
>NC_020300, from 1204607 to 1204630 (24 bp); Bartonella australis Aust NH1 TCTTCACCTTCAACTTCATCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1204564-1205658	Sequence	BAnh1_09620 - phage protein (Protein is coded in complementary strand; from 1205658 to 1204564)