Sequence retrieval

Genome: Bartonella australis Aust NH1
Start position: 1215037
End position: 1215091
Length: 55

DNA sequence
>NC_020300, from 1215037 to 1215091 (55 bp); Bartonella australis Aust NH1 GCATTGCTCATGCATTGCCCATGCATTGCTTGTGCATTACTCATGCATTGCTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1214368-1215486	Sequence	BAnh1_09740 - hypothetical protein (Protein is coded in complementary strand; from 1215486 to 1214368)