Sequence retrieval

Genome: Bartonella australis Aust NH1
Start position: 1303619
End position: 1303645
Length: 27

DNA sequence
>NC_020300, from 1303619 to 1303645 (27 bp); Bartonella australis Aust NH1 CATGGATATGATGGATATAATGGATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1302882-1306034	Sequence	BAnh1_10310 iba2 Inducible Bartonella autotransporter