Sequence retrieval

Genome: Bartonella australis Aust NH1
Start position: 1322678
End position: 1322704
Length: 27

DNA sequence
>NC_020300, from 1322678 to 1322704 (27 bp); Bartonella australis Aust NH1 CCATTCCGCCCATTCCACCCATTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1322671-1324314	Sequence	BAnh1_10450 groEL chaperonin GroEL (Protein is coded in complementary strand; from 1324314 to 1322671)