Sequence retrieval

Genome: Bartonella australis Aust NH1
Start position: 1375737
End position: 1375766
Length: 30

DNA sequence
>NC_020300, from 1375737 to 1375766 (30 bp); Bartonella australis Aust NH1 CCCGCGCAGTCCCCCGCGGTCCTGCGCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1375439-1375849	Sequence	BAnh1_10900 - hypothetical protein (Protein is coded in complementary strand; from 1375849 to 1375439)