Sequence retrieval

Genome: Bartonella australis Aust NH1
Start position: 1527094
End position: 1527147
Length: 54

DNA sequence
>NC_020300, from 1527094 to 1527147 (54 bp); Bartonella australis Aust NH1 TTCAGCCGCCGACGCTTCTTCGGCCGCCAATGCTTCTTCGGCCGCCAATGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1527062-1527481	Sequence	BAnh1_12350 rpsP 30S ribosomal protein S16 (Protein is coded in complementary strand; from 1527481 to 1527062)