Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2536371
End position: 2536394
Length: 24

DNA sequence
>NC_020376, from 2536371 to 2536394 (24 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AAAGATAAAAATATAAAACGATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2535434-2536450	Sequence	H175_ch2522 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 2536450 to 2535434)