Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4499796
End position: 4499819
Length: 24

DNA sequence
>NC_020376, from 4499796 to 4499819 (24 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTATCTTTATCCTTATTTTTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4498728-4499954	Sequence	H175_ch4601 - hypothetical protein (Protein is coded in complementary strand; from 4499954 to 4498728)