Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4796566
End position: 4796589
Length: 24

DNA sequence
>NC_020376, from 4796566 to 4796589 (24 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTCTCTTTTTCTCTTCTTCACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4796343-4796831	Sequence	H175_ch4924 - Cell wall surface anchor family protein (Protein is coded in complementary strand; from 4796831 to 4796343)