Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4924860
End position: 4924883
Length: 24

DNA sequence
>NC_020376, from 4924860 to 4924883 (24 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TAACCAATCAACCAATTCACCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4923916-4927308	Sequence	H175_ch5037 - Phage tail length tape-measure protein (Protein is coded in complementary strand; from 4927308 to 4923916)