Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 760829
End position: 760852
Length: 24

DNA sequence
>NC_020376, from 760829 to 760852 (24 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TCTGCTTCTGCATATGCTTTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 759872-761287	Sequence	H175_ch0687 - Arginine permease RocE (Protein is coded in complementary strand; from 761287 to 759872)