Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1473725
End position: 1473749
Length: 25

DNA sequence
>NC_020376, from 1473725 to 1473749 (25 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AAAAATAAAATAAAAATAAAAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1473524-1473733	Sequence	H175_ch1436 - hypothetical protein