Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1701107
End position: 1701131
Length: 25

DNA sequence
>NC_020376, from 1701107 to 1701131 (25 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AAGAAAAGGAAAGAAAAGCAAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1701032-1701586	Sequence	H175_ch1677 - Thiol:disulfide oxidoreductase related to ResA