Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2537533
End position: 2537557
Length: 25

DNA sequence
>NC_020376, from 2537533 to 2537557 (25 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AAAATAAAAACAAATAAGATACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2536626-2537783	Sequence	H175_ch2523 - sensor histidine kinase (Protein is coded in complementary strand; from 2537783 to 2536626)