Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3806120
End position: 3806144
Length: 25

DNA sequence
>NC_020376, from 3806120 to 3806144 (25 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTTTTGTTTTTTCTTGTTTTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3806031-3806201	Sequence	H175_ch3837 - Phage protein (Protein is coded in complementary strand; from 3806201 to 3806031)