Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 5270925
End position: 5270949
Length: 25

DNA sequence
>NC_020376, from 5270925 to 5270949 (25 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTCTTTTCTATACTTTTGTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5270899-5271105	Sequence	H175_ch5409 - Stage III sporulation protein D (Protein is coded in complementary strand; from 5271105 to 5270899)