Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 5406402
End position: 5406426
Length: 25

DNA sequence
>NC_020376, from 5406402 to 5406426 (25 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTTCTTTTCTTTTATATTCTTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5406295-5407866	Sequence	H175_ch5544 - sensor histidine kinase, putative (Protein is coded in complementary strand; from 5407866 to 5406295)