Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 836761
End position: 836785
Length: 25

DNA sequence
>NC_020376, from 836761 to 836785 (25 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTTTTATTTTTTTCTTATTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 835632-836831	Sequence	H175_ch0765 - Cell envelope-associated transcriptional attenuator LytR-CpsA-Psr (Protein is coded in complementary strand; from 836831 to 835632)