Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1222894
End position: 1222920
Length: 27

DNA sequence
>NC_020376, from 1222894 to 1222920 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TGGTCCAGTCGGTCCAGTCGGTCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1222484-1223290	Sequence	H175_ch1158 - BclA protein (Protein is coded in complementary strand; from 1223290 to 1222484)