Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1529469
End position: 1529495
Length: 27

DNA sequence
>NC_020376, from 1529469 to 1529495 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TCATGGACATCATGGACATCATGGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1529210-1529638	Sequence	H175_ch1502 - Inner spore coat protein D