Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 176699
End position: 176725
Length: 27

DNA sequence
>NC_020376, from 176699 to 176725 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CGTCTTTTAAGTCTTTTACATCTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 176278-177090	Sequence	H175_ch0162 - Methionine ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 177090 to 176278)