Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2378216
End position: 2378242
Length: 27

DNA sequence
>NC_020376, from 2378216 to 2378242 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AACGGGAGTAACGGGAGTAACGGGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2377699-2378682	Sequence	H175_ch2394 - Collagen triple helix repeat protein