Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2380262
End position: 2380288
Length: 27

DNA sequence
>NC_020376, from 2380262 to 2380288 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CAACAGGTCCAACAGGTCCAACAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2379515-2380843	Sequence	H175_ch2396 - Exosporium protein J