Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2602093
End position: 2602119
Length: 27

DNA sequence
>NC_020376, from 2602093 to 2602119 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GGTTGTGGTCGTTGTGGTGGTTGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2601965-2602294	Sequence	H175_ch2587 - keratin associated protein 17-1