Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3251619
End position: 3251645
Length: 27

DNA sequence
>NC_020376, from 3251619 to 3251645 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AGGTACTGGTGGTACTGGTGGTACTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3251317-3252162	Sequence	H175_ch3286 - hypothetical protein (Protein is coded in complementary strand; from 3252162 to 3251317)