Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3293820
End position: 3293846
Length: 27

DNA sequence
>NC_020376, from 3293820 to 3293846 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CCTGGTGGACCTGGTGGACCTGATGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3292866-3294743	Sequence	H175_ch3331 - Phage tail fiber protein (Protein is coded in complementary strand; from 3294743 to 3292866)